Illumina nextera index sequences

x2 Sequences for Nextera, Illumina Prep, and Illumina PCR Kits. Adapter Trimming. The following sequence is used for Read 1 and Read 2 adapter trimming. CTGTCTCTTATACACATCT. llumina DNA PCR-Free Prep, Tagmentation Adapter Trimming. The following sequence includes two adapter sequences joined by a plus sign. When performing adapter trimming, the software independently assesses each adapter for trimming. Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Enter 10 cycles each for Index 1 and Index 2 to ensure that the software reads the complete 10-base index adapter sequence. For the recommended number of Read 1 and Read 2 cycles, see the Compatible Products page for your kit. Illumina DNA Prep Compatible Products; Illumina DNA Prep with Enrichment Compatible Products; Nextera XT DNA Compatible ...This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and Nov 10, 2021 · Index sequences entered in the wrong orientation in the sample sheet. Incorrect index sequences entered in the sample sheet (eg, Nextera vs TruSeq UD or index A001 vs index A006). Sample mix ups between lanes. Poor Index Read sequencing quality. Ns in the sequences represent positions where the base calling software was unable to make a base call. Library Prep and Array Kit Selector. Determine the best kit for your project type, starting material, and method or application. Sequencing Coverage Calculator. Determine reagents and sequencing runs for your desired coverage. Use the following sample sheet templates with IDT for Illumina Nextera DNA UD Indexes. Dual-index sequencing on a paired-end flow cell follows 1 of 2 workflows, depending on the system: Workflow A — The Index 2 Read is performed before Read 2 resynthesis, so the Index 2 (i5) adapter is sequenced on the forward strand.Index Name i7Basesin Adapter i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA UDP0002 TATCTGACCT AGGTCAGATA CTACAAGATA TATCTTGTAG UDP0003 ATATGAGACG CGTCTCATAT TATAGTAGCT AGCTACTATAThe PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility.May 19, 2021 · This step will improve downstream data processing, such as sequence alignments and de novo assembly. The exact DNA sequence of the adapters depends on the library preparation kit that is used for sequencing. Illumina Nextera XT is one of our most used kits. The adapter sequence for this kit is: CTGTCTCTTATACACATCT This document provides the nucleotide sequences that comprise Illumina oligonucleotides used in Illumina sequencing technologies. These sequences are provided for the sole purpose of understanding and publishing the results of your sequencing experiments. Proprietary to Illumina The oligonucleotides are proprietary to Illumina.Sequencing in the Same Channel: The Nextera sequencing primers are compatible with the Illumina sequencing primers, and can be used together. 9. Nextera PCR Enzyme: Use only Nextera PCR Enzyme for limited-cycle PCR (Step B, page 7). Other PCR systems have been tested and do not perform as well.May 19, 2021 · This step will improve downstream data processing, such as sequence alignments and de novo assembly. The exact DNA sequence of the adapters depends on the library preparation kit that is used for sequencing. Illumina Nextera XT is one of our most used kits. The adapter sequence for this kit is: CTGTCTCTTATACACATCT Illumina DNA Prep technology can be used to reduce library prep time from DNA extraction to library normalization, in applications such as: Whole-genome sequencing of any species (large or small) for various applications. Sequencing large numbers of genomic regions of interest, including whole exomes from Illumina or third party oligo vendors. Nov 10, 2021 · Index sequences entered in the wrong orientation in the sample sheet. Incorrect index sequences entered in the sample sheet (eg, Nextera vs TruSeq UD or index A001 vs index A006). Sample mix ups between lanes. Poor Index Read sequencing quality. Ns in the sequences represent positions where the base calling software was unable to make a base call. Libraries prepared with Nextera XT kits are compatible with all Illumina sequencers. The IDT for Illumina-Nextera DNA UD Indexes Sets A, B, C, and D Indexes offer up to 384 unique dual indexing, which allows accurate assignment of reads and efficient use of the flow cell. These unique dual index codes use 10 bp codes.The Nextera Index Kit also packages Index 1 and Index 2 adapters in tubes, and is available in two sizes: • The 24 indexes, 96 samples size contains six Index 1 and four Index 2 adapters. • The 96 indexes, 384 samples size contains 12 Index 1 adapters and eight Index 2 adapters. Dual Indexing Single Indexing With Dual Index AdaptersJan 08, 2018 · The adapter oligo sequence is the same as the standard Illumina TruSeq HT (“TS-96”) dual indexed adapter; however, for each individual adapter, the i5 and i7 index sequences are identical, resulting in both the forward and reverse read indices having the same sequence, and the adapter contains a UMI appended to the 3′ end of the i7 index ... Nextera DNA CD Indexes (24 indexes, 24 samples) contain six Index 1 (i7) adapters and four Index 2 (i5) adapters packaged in tubes. The following table shows strategies for pooling 3–8 dual-indexed libraries prepared with these indexes. A minimum plexity of three ensures that libraries are color balanced for sequencing on any Illumina system ... Jun 13, 2020 · Option 1: Standard Nextera Flex. Allow BLT to equilibrate to room temp on the bench top for at least 30 minutes before use. Bring TB1 to room temp. Add 2–30 µl DNA to each well of a 96-well PCR plate so that the total input amount is 1–500 ng. If input is <100ng, quantify and normalize. Illumina Adapter Sequences: Nextera Index Kit - Index 2 (i5) Adapters: The i5 index names vary for different Nextera products as follows: • • • N50x—Nextera DNA: S50x—Nextera XT: E50x—Nextera Enrichment and Nextera Rapid Capture: i5 Bases for Sample Sheet: Bases in Adapter i5 Index Name MiSeq, HiSeq 2000/2500: i5 Bases for Sample Sheet Product Files This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. You can also download the appropriate sample sheet template (*.csv).Each Nextera XT library preparation kit requires one of the following Nextera XT Index Kits* to complete the protocol, regardless of the sample pooling level used for sequencing. Nextera XT V2 Index Kit set A, B, C, or D (96 indexes, 384 samples each – combine all four for 384 index combinations) Nextera XT Index Kit (24 indexes, 96 samples) Sep 28, 2017 · In theory when the insert is shorter than the read length you do read into the adapter at other end and then will sequence the index. Problem is not all inserts in your library are the same length and may not even be shorter than read length. So you would not be guaranteed to reach and read the index each time. S5xx—Nextera XT Index Kit v2. i5 Index Name. Bases in Adapter. i5 Bases for Sample Sheet. NovaSeq 6000 with v1.0 reagent kits, MiSeq, HiSeq 2000/2500, NextSeq 2000 (Sample Sheet v2) i5 Bases for Sample Sheet. iSeq, NovaSeq 6000 with v1.5 reagent kits, MiniSeq, NextSeq 500/550, HiSeq 3000/4000/X, NextSeq 2000 (Sample Sheet v1) [E/H/N/S]501.This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA.Libraries prepared with Nextera XT kits are compatible with all Illumina sequencers. The IDT for Illumina-Nextera DNA UD Indexes Sets A, B, C, and D Indexes offer up to 384 unique dual indexing, which allows accurate assignment of reads and efficient use of the flow cell. These unique dual index codes use 10 bp codes. Overview of the Illumina sequencing workflow, from extracting nucleic acids to completing a sequencing run. Start Course Sequencing: Fundamentals Description of DNA and RNA with a discussion on traditional sequencing and how it compares to sequencing by synthesis. Start Course Preventing ContaminationIllumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy <b ... Use the following sample sheet templates with IDT for Illumina Nextera DNA UD Indexes. Dual-index sequencing on a paired-end flow cell follows 1 of 2 workflows, depending on the system: Workflow A — The Index 2 Read is performed before Read 2 resynthesis, so the Index 2 (i5) adapter is sequenced on the forward strand.This document provides the nucleotide sequences that comprise Illumina oligonucleotides used in Illumina sequencing technologies. These sequences are provided for the sole purpose of understanding and publishing the results of your sequencing experiments. Proprietary to Illumina The oligonucleotides are proprietary to Illumina.The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Illumina Sequencing. Illumina sequencers deliver the most flexible and longest available reads of the shorter-read-length platforms, crossing important length thresholds to facilitate many genomic applications. Sequencing on an Illumina sequencer can be done by generating data from one end (single-end reads=SE) of the library fragments or from ... Overview of Indexed Sequencing on the NextSeq, MiSeq, and HiSeq Platforms Author: Illumina Subject: Description of indexed workflows on Illumina sequencing platforms. Created Date: 2/12/2015 9:38:15 AM Illumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy <b ... Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Illumina DNA Prep technology powers the fastest and most flexible sequencing solutions for DNA in the Illumina library prep portfolio. On-bead tagmentation chemistry reduces total workflow time for whole genome and targeted enrichment workflows. Illumina DNA Prep products represent the latest revolution in Illumina library prep chemistry.Nextera DNA CD Indexes (24 indexes, 24 samples) contain six Index 1 (i7) adapters and four Index 2 (i5) adapters packaged in tubes. The following table shows strategies for pooling 3-8 dual-indexed libraries prepared with these indexes. A minimum plexity of three ensures that libraries are color balanced for sequencing on any Illumina system.This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. Illumina Sequencing. Illumina sequencers deliver the most flexible and longest available reads of the shorter-read-length platforms, crossing important length thresholds to facilitate many genomic applications. Sequencing on an Illumina sequencer can be done by generating data from one end (single-end reads=SE) of the library fragments or from ... Illumina Adapter Sequences Document # 1000000002694v06 5 February 2018 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for AmpliSeq for Illumina, TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists Aug 01, 2020 · However, here, we observed a decrease of sequence quality in samples containing a specific combination of indexes, namely N704 and S507 in Nextera kits, in multiple runs on the Illumina MiSeq sequencer operated in different facilities. Aug 01, 2020 · However, here, we observed a decrease of sequence quality in samples containing a specific combination of indexes, namely N704 and S507 in Nextera kits, in multiple runs on the Illumina MiSeq sequencer operated in different facilities. Sequences for Nextera, Illumina Prep, and Illumina PCR Kits. Adapter Trimming. The following sequence is used for Read 1 and Read 2 adapter trimming. ... Index 2 Read. 5′ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC. Close Window. Revision History. Document # 1000000002694 v16. Documentation Feedback.The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Illumina DNA Prep technology powers the fastest and most flexible sequencing solutions for DNA in the Illumina library prep portfolio. On-bead tagmentation chemistry reduces total workflow time for whole genome and targeted enrichment workflows. Illumina DNA Prep products represent the latest revolution in Illumina library prep chemistry.The adaptor sequences in the middle like Truseq Read 1, Truseq Read 2, Nextera Read 1 and Nextera Read 2 can be changed. The entire kit costs $3,800 and it is sufficient for 10 experiments: Other consumables : Plates, tips, tubes: $40 : Charge for the use of the C1 instrument : $50: For one experiment: Estimated total cost for one mRNAseq C1 ... This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and Nextera XT Indexes (24 indexes, 96 samples) are compatible with the Nextera DNA XT Library Prep Kit and bead-based normalization. For standard normalization, use the IDT for Illumina Nextera DNA UD Indexes. The Nextera XT Indexes (96 indexes, 384 samples) (catalog # FC-131-1002) was obsolesced with the introduction of the Nextera XT Index Kit v2.N504) for the 24 sample Nextera Index Kit (FC-121–1011). In the Index adapter name, the N refers to Nextera sample preparation, 7 or 5 refers to Index 1 (i7) or Index 2 (i5), respectively, and 01–12 refers to the Index number. A list of index sequences is provided for generating sample sheets to demultiplex the samples (Table 1). Nextera ... Product Description IDT for Illumina DNA/RNA UD Indexes are extension-based unique dual (UD) indexes with unrelated adapters for both index reads. The index adapter sequences are 10 bases long. Sample Information Before preparing libraries, create a sample sheet to record the index adapter combinations and other information about your samples.The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Illumina Adapter Sequences: Nextera Index Kit - Index 2 (i5) Adapters: The i5 index names vary for different Nextera products as follows: • • • N50x—Nextera DNA: S50x—Nextera XT: E50x—Nextera Enrichment and Nextera Rapid Capture: i5 Bases for Sample Sheet: Bases in Adapter i5 Index Name MiSeq, HiSeq 2000/2500: i5 Bases for Sample Sheet Nextera DNA CD Indexes support up to 96-sample combinatorial dual indexing. The 24 CD Indexes are supplied in a tube format, and 96 in a plate format. For whole-genome sequencing, Illumina DNA Prep is the recommended replacement for the Nextera DNA Library Prep Kit, which has been discontinued.The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Nextera XT Index Kit v2 Set B (96 Indexes, 384 Samples), Store at -25° to -15°C. Reagent. Description. Index Primers. S502, S503, S505 to S508, S510, S511. Index Primers. Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA.Nextera XT DNA Library Preparation Kit Download: Data Sheet < 1 MB: Sequencing the Rapidly Evolving Influenza A Virus on the MiSeq System Download: Application Note < 1 MB: Apr 26, 2017: Nextera Library Validation and Cluster Density Optimization Download: Technical Note < 1 MB: Dec 6, 2018: Nextera XT Library Prep: Tips and Troubleshooting ... Nextera XT Indexes (24 indexes, 96 samples) are compatible with the Nextera DNA XT Library Prep Kit and bead-based normalization. For standard normalization, use the IDT for Illumina Nextera DNA UD Indexes. The Nextera XT Indexes (96 indexes, 384 samples) (catalog # FC-131-1002) was obsolesced with the introduction of the Nextera XT Index Kit v2.Jan 08, 2018 · The adapter oligo sequence is the same as the standard Illumina TruSeq HT (“TS-96”) dual indexed adapter; however, for each individual adapter, the i5 and i7 index sequences are identical, resulting in both the forward and reverse read indices having the same sequence, and the adapter contains a UMI appended to the 3′ end of the i7 index ... The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Prepared libraries were subjected to 100 base pair, paired-end sequencing on a HiSeq 2500 ( Illumina ... and the Illumina Nextera transposase and adapter sequences . In addition, reads were trimmed by 16bp at the 5' end to26].. Illumina - all flavors. ...Library Prep and Array Kit Selector. Determine the best kit for your project type, starting material, and method or application. Sequencing Coverage Calculator. Determine reagents and sequencing runs for your desired coverage. Guidelines for preparing libraries with balanced index combinations for sequencing on Illumina systems. View Online Help Apr 26, 2021. Illumina Adapter Sequences ... Nextera Library Validation and Cluster Density Optimization Download: Technical Note < 1 MB: Dec 6, 2018: Nextera XT Library Prep: Tips and TroubleshootingNextera DNA CD Indexes support up to 96-sample combinatorial dual indexing. The 24 CD Indexes are supplied in a tube format, and 96 in a plate format. For whole-genome sequencing, Illumina DNA Prep is the recommended replacement for the Nextera DNA Library Prep Kit, which has been discontinued.Below are the 12 barcodes used in the Illumina TruSeq system, they are base-balanced and work well as In-Line barcodes as well as Multiplex. ATCACG CGATGT TTAGGC TGACCA ACATGT GCCAAT . CAGATC ACTTGA GATCAG TAGCTT GGCTAG CTTGTA . At this time, Illumina TruSeq adapters and primers are only available in the TruSeq kits from Illumina. RevisionHistory Document Date DescriptionofChange Document# 15027987v01 January 2016 •ChangedtitleofthisdocumenttoReferenceGuide •UpdatedtonewlibraryprepstyleIllumina Sequencing. Illumina sequencers deliver the most flexible and longest available reads of the shorter-read-length platforms, crossing important length thresholds to facilitate many genomic applications. Sequencing on an Illumina sequencer can be done by generating data from one end (single-end reads=SE) of the library fragments or from ... • IDT for Illumina Nextera DNA UD Indexes, Plate D adapter sequences for i5 bases iSeq, MiniSeq, NextSeq, HiSeq 3000/4000. • TruSight Tumor 170 UP08 i7 and i5 index names. • TruSight Tumor 170 UP08 and UP09 i7 adapter sequences. Document # 1000000002694 v11 April 2019 Added adapter sequences for IDT for Illumina Tagment Genomic DNA NexteraDNALibraryPrepReferenceGuide 9 TagmentGenomicDNA ThisstepusestheNexteratranspsometotagmentgDNA,whichisaprocessthat ... Feb 22, 2018 · Nextera XT Library prep kits have 2 sets of index primers (Index 1 and 2). Index 1 has up to 12 unique primers, while index 2 has up to 8 unique primers. A unique combination of an Index 1 and Index 2 primers are mixed with each sample, thus giving amplicons of each sample its own label after index PCR. Sequencing in the Same Channel: The Nextera sequencing primers are compatible with the Illumina sequencing primers, and can be used together. 9. Nextera PCR Enzyme: Use only Nextera PCR Enzyme for limited-cycle PCR (Step B, page 7). Other PCR systems have been tested and do not perform as well.Guidelines for preparing libraries with balanced index combinations for sequencing on Illumina systems. View Online Help Apr 26, 2021. Illumina Adapter Sequences ... Nextera Library Validation and Cluster Density Optimization Download: Technical Note < 1 MB: Dec 6, 2018: Nextera XT Library Prep: Tips and TroubleshootingThe PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Illumina innovative sequencing and array technologies are fueling groundbreaking advancements in life science research, translational and consumer genomics, and molecular diagnostics. Illumina Korea 14F KTB Building 66 Yeoidaero Yeoungdeungpo-gu Seoul Korea 07325 Illumina nextera xt index sequences. Illumina index adapter sequences. Related websites. Indexed Sequencing Overview for Illumina Systems. This documentation provides an overview of indexed sequencing for Illumina sequencing systems. Indexed sequencing is a method that allows multiple libraries to be pooled and sequenced together. Indexing ...The adaptor sequences in the middle like Truseq Read 1, Truseq Read 2, Nextera Read 1 and Nextera Read 2 can be changed. The entire kit costs $3,800 and it is sufficient for 10 experiments: Other consumables : Plates, tips, tubes: $40 : Charge for the use of the C1 instrument : $50: For one experiment: Estimated total cost for one mRNAseq C1 ... Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Tagment Genomic DNA NexteraDNALibraryPrepReferenceGuide 9 TagmentGenomicDNA ThisstepusestheNexteratranspsometotagmentgDNA,whichisaprocessthat ... The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Sep 28, 2017 · In theory when the insert is shorter than the read length you do read into the adapter at other end and then will sequence the index. Problem is not all inserts in your library are the same length and may not even be shorter than read length. So you would not be guaranteed to reach and read the index each time. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. • IDT for Illumina Nextera DNA UD Indexes, Plate D adapter sequences for i5 bases iSeq, MiniSeq, NextSeq, HiSeq 3000/4000. • TruSight Tumor 170 UP08 i7 and i5 index names. • TruSight Tumor 170 UP08 and UP09 i7 adapter sequences. Document # 1000000002694 v11 April 2019 Added adapter sequences for IDT for Illumina Nextera DNA CD Indexes (24 indexes, 24 samples) contain six Index 1 (i7) adapters and four Index 2 (i5) adapters packaged in tubes. The following table shows strategies for pooling 3–8 dual-indexed libraries prepared with these indexes. A minimum plexity of three ensures that libraries are color balanced for sequencing on any Illumina system ... Illumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy <b ... The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and The IDT for Illumina RNA UD Indexes Sets A and B, Ligation kits (catalog numbers 20040553 and 20040554, respectively) include one IDT for Illumina DNA/RNA UD Index plate and one RNA Index Anchor plate. In contrast, IDT for Illumina DNA/RNA UD Indexes, Tagmentation kits only include the index plate.Illumina Sequencing. Illumina sequencers deliver the most flexible and longest available reads of the shorter-read-length platforms, crossing important length thresholds to facilitate many genomic applications. Sequencing on an Illumina sequencer can be done by generating data from one end (single-end reads=SE) of the library fragments or from ... The benefits of unique dual indexing include: Greater efficiency for multiplexing. Reduced per-sample cost by allowing more indexes to be included in a sequencing run compared to combinatorial dual or single indexes. Highly purified and manufactured under Good Manufacturing Practice (GMP) conditions. Improved design with color balance in mind. Sep 28, 2017 · In theory when the insert is shorter than the read length you do read into the adapter at other end and then will sequence the index. Problem is not all inserts in your library are the same length and may not even be shorter than read length. So you would not be guaranteed to reach and read the index each time. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Prepared libraries were subjected to 100 base pair, paired-end sequencing on a HiSeq 2500 ( Illumina ... and the Illumina Nextera transposase and adapter sequences . In addition, reads were trimmed by 16bp at the 5' end to26].. Illumina - all flavors. ...The benefits of unique dual indexing include: Greater efficiency for multiplexing. Reduced per-sample cost by allowing more indexes to be included in a sequencing run compared to combinatorial dual or single indexes. Highly purified and manufactured under Good Manufacturing Practice (GMP) conditions. Improved design with color balance in mind. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. The benefits of unique dual indexing include: Greater efficiency for multiplexing. Reduced per-sample cost by allowing more indexes to be included in a sequencing run compared to combinatorial dual or single indexes. Highly purified and manufactured under Good Manufacturing Practice (GMP) conditions. Improved design with color balance in mind. Mar 18, 2013 · Nextera XT index sequence 03-18-2013, 10:33 AM ... I'm hesitant to say anything more about them since they are patented by Illumina with limited permission for ... Libraries prepared with Nextera XT kits are compatible with all Illumina sequencers. The IDT for Illumina-Nextera DNA UD Indexes Sets A, B, C, and D Indexes offer up to 384 unique dual indexing, which allows accurate assignment of reads and efficient use of the flow cell. These unique dual index codes use 10 bp codes.Product Files This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. You can also download the appropriate sample sheet template (*.csv).Libraries prepared with Nextera XT kits are compatible with all Illumina sequencers. The IDT for Illumina-Nextera DNA UD Indexes Sets A, B, C, and D Indexes offer up to 384 unique dual indexing, which allows accurate assignment of reads and efficient use of the flow cell. These unique dual index codes use 10 bp codes. Illumina Adapter Sequences: Nextera Index Kit - Index 2 (i5) Adapters: The i5 index names vary for different Nextera products as follows: • • • N50x—Nextera DNA: S50x—Nextera XT: E50x—Nextera Enrichment and Nextera Rapid Capture: i5 Bases for Sample Sheet: Bases in Adapter i5 Index Name MiSeq, HiSeq 2000/2500: i5 Bases for Sample Sheet This package can be used as part of the NGS Library Preparation protocol for Illumina Nextera XT. This package contains: Two sets of barcode indices : Illumina Nextera XT Index Kit and Illumina Nextera XT Index Kit v2. This is based on document: Illumina Adapter Sequences (1000000002694 v16) , Illumina Adapter Sequences v16. The products previously known as IDT for Illumina Nextera DNA Unique Dual Indexes Sets A and B (Cat. No. 20027213 and 20027214) are now called IDT for Illumina DNA/RNA UD Indexes Sets A and B. ... The index sequences and kit configurations have not changed. Illumina DNA Prep with Enrichment. A fast, integrated workflow for a wide range of ...Mar 18, 2013 · Nextera XT index sequence 03-18-2013, 10:33 AM ... I'm hesitant to say anything more about them since they are patented by Illumina with limited permission for ... Library Prep and Array Kit Selector. Determine the best kit for your project type, starting material, and method or application. Sequencing Coverage Calculator. Determine reagents and sequencing runs for your desired coverage. Mar 18, 2013 · Nextera XT index sequence 03-18-2013, 10:33 AM ... I'm hesitant to say anything more about them since they are patented by Illumina with limited permission for ... Use the following sample sheet templates with IDT for Illumina Nextera DNA UD Indexes. Dual-index sequencing on a paired-end flow cell follows 1 of 2 workflows, depending on the system: Workflow A — The Index 2 Read is performed before Read 2 resynthesis, so the Index 2 (i5) adapter is sequenced on the forward strand. S5xx—Nextera XT Index Kit v2. i5 Index Name. Bases in Adapter. i5 Bases for Sample Sheet. NovaSeq 6000 with v1.0 reagent kits, MiSeq, HiSeq 2000/2500, NextSeq 2000 (Sample Sheet v2) i5 Bases for Sample Sheet. iSeq, NovaSeq 6000 with v1.5 reagent kits, MiniSeq, NextSeq 500/550, HiSeq 3000/4000/X, NextSeq 2000 (Sample Sheet v1) [E/H/N/S]501. It is not recommended to sequence libraries made from different index sets (i.e. Nextera CD Indexes, IDT for Illumina TruSeq UD Indexes, or Nextera XT Index Kits). ... TruSeq Stranded mRNA, and TruSeq Stranded Total RNA library prep kits. The IDT for Illumina Nextera UD Indexes are extension based indexes that are compatible with the Nextera ...Enter 10 cycles each for Index 1 and Index 2 to ensure that the software reads the complete 10-base index adapter sequence. For the recommended number of Read 1 and Read 2 cycles, see the Compatible Products page for your kit. Illumina DNA Prep Compatible Products; Illumina DNA Prep with Enrichment Compatible Products; Nextera XT DNA Compatible ... This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and The products previously known as IDT for Illumina Nextera DNA Unique Dual Indexes Sets A and B (Cat. No. 20027213 and 20027214) are now called IDT for Illumina DNA/RNA UD Indexes Sets A and B. ... The index sequences and kit configurations have not changed. Illumina DNA Prep with Enrichment. A fast, integrated workflow for a wide range of ...Use the following sample sheet templates with IDT for Illumina Nextera DNA UD Indexes. Dual-index sequencing on a paired-end flow cell follows 1 of 2 workflows, depending on the system: Workflow A — The Index 2 Read is performed before Read 2 resynthesis, so the Index 2 (i5) adapter is sequenced on the forward strand. Nextera XT Index Kit v2 Set B (96 Indexes, 384 Samples), Store at -25° to -15°C. Reagent. Description. Index Primers. S502, S503, S505 to S508, S510, S511. Index Primers. S5xx—Nextera XT Index Kit v2. i5 Index Name. Bases in Adapter. i5 Bases for Sample Sheet. NovaSeq 6000 with v1.0 reagent kits, MiSeq, HiSeq 2000/2500, NextSeq 2000 (Sample Sheet v2) i5 Bases for Sample Sheet. iSeq, NovaSeq 6000 with v1.5 reagent kits, MiniSeq, NextSeq 500/550, HiSeq 3000/4000/X, NextSeq 2000 (Sample Sheet v1) [E/H/N/S]501. The products previously known as IDT for Illumina Nextera DNA Unique Dual Indexes Sets A and B (Cat. No. 20027213 and 20027214) are now called IDT for Illumina DNA/RNA UD Indexes Sets A and B. ... The index sequences and kit configurations have not changed. Illumina DNA Prep with Enrichment. A fast, integrated workflow for a wide range of ...Use the following sample sheet templates with IDT for Illumina Nextera DNA UD Indexes. Dual-index sequencing on a paired-end flow cell follows 1 of 2 workflows, depending on the system: Workflow A — The Index 2 Read is performed before Read 2 resynthesis, so the Index 2 (i5) adapter is sequenced on the forward strand.Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Illumina Adapter Sequences: Nextera Index Kit - Index 2 (i5) Adapters: The i5 index names vary for different Nextera products as follows: • • • N50x—Nextera DNA: S50x—Nextera XT: E50x—Nextera Enrichment and Nextera Rapid Capture: i5 Bases for Sample Sheet: Bases in Adapter i5 Index Name MiSeq, HiSeq 2000/2500: i5 Bases for Sample Sheet Nextera XT Index Kit v2 Set B (96 Indexes, 384 Samples), Store at -25° to -15°C. Reagent. Description. Index Primers. S502, S503, S505 to S508, S510, S511. Index Primers. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Illumina Sequencing. Illumina sequencers deliver the most flexible and longest available reads of the shorter-read-length platforms, crossing important length thresholds to facilitate many genomic applications. Sequencing on an Illumina sequencer can be done by generating data from one end (single-end reads=SE) of the library fragments or from ... Index Name i7Basesin Adapter i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA UDP0002 TATCTGACCT AGGTCAGATA CTACAAGATA TATCTTGTAG UDP0003 ATATGAGACG CGTCTCATAT TATAGTAGCT AGCTACTATAUse the following sample sheet templates with IDT for Illumina Nextera DNA UD Indexes. Dual-index sequencing on a paired-end flow cell follows 1 of 2 workflows, depending on the system: Workflow A — The Index 2 Read is performed before Read 2 resynthesis, so the Index 2 (i5) adapter is sequenced on the forward strand.Libraries prepared with Nextera XT kits are compatible with all Illumina sequencers. The IDT for Illumina-Nextera DNA UD Indexes Sets A, B, C, and D Indexes offer up to 384 unique dual indexing, which allows accurate assignment of reads and efficient use of the flow cell. These unique dual index codes use 10 bp codes.Jan 08, 2018 · The adapter oligo sequence is the same as the standard Illumina TruSeq HT (“TS-96”) dual indexed adapter; however, for each individual adapter, the i5 and i7 index sequences are identical, resulting in both the forward and reverse read indices having the same sequence, and the adapter contains a UMI appended to the 3′ end of the i7 index ... N504) for the 24 sample Nextera Index Kit (FC-121–1011). In the Index adapter name, the N refers to Nextera sample preparation, 7 or 5 refers to Index 1 (i7) or Index 2 (i5), respectively, and 01–12 refers to the Index number. A list of index sequences is provided for generating sample sheets to demultiplex the samples (Table 1). Nextera ... Product Description IDT for Illumina DNA/RNA UD Indexes are extension-based unique dual (UD) indexes with unrelated adapters for both index reads. The index adapter sequences are 10 bases long. Sample Information Before preparing libraries, create a sample sheet to record the index adapter combinations and other information about your samples.This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. Nextera DNA CD Indexes support up to 96-sample combinatorial dual indexing. The 24 CD Indexes are supplied in a tube format, and 96 in a plate format. For whole-genome sequencing, Illumina DNA Prep is the recommended replacement for the Nextera DNA Library Prep Kit, which has been discontinued.Illumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy <b ... Sep 28, 2017 · In theory when the insert is shorter than the read length you do read into the adapter at other end and then will sequence the index. Problem is not all inserts in your library are the same length and may not even be shorter than read length. So you would not be guaranteed to reach and read the index each time. Product Files This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. You can also download the appropriate sample sheet template (*.csv).In the sequencing reagents provided by Illumina, the seuqencing primers are actually a mixture of different primers, including Truseq, Nextera and even those primers from kits that are obsolete. Therefore, you actually can sequence different types of libraries together. For example, Truseq librareis and Nextera libraries can be mixed together ...This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. Product Files This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. You can also download the appropriate sample sheet template (*.csv).Illumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy <b ... Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Index Name i7Basesin Adapter i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA UDP0002 TATCTGACCT AGGTCAGATA CTACAAGATA TATCTTGTAG UDP0003 ATATGAGACG CGTCTCATAT TATAGTAGCT AGCTACTATA Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Nov 10, 2021 · Index sequences entered in the wrong orientation in the sample sheet. Incorrect index sequences entered in the sample sheet (eg, Nextera vs TruSeq UD or index A001 vs index A006). Sample mix ups between lanes. Poor Index Read sequencing quality. Ns in the sequences represent positions where the base calling software was unable to make a base call. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Illumina Adapter Sequences . Document # 1000000002694 v00 . 6. October 2015 . TruSight Cardio. Index 1 (i7) Adapters . i7 Index Name i7 Bases for Sample SheetThe IDT for Illumina RNA UD Indexes Sets A and B, Ligation kits (catalog numbers 20040553 and 20040554, respectively) include one IDT for Illumina DNA/RNA UD Index plate and one RNA Index Anchor plate. In contrast, IDT for Illumina DNA/RNA UD Indexes, Tagmentation kits only include the index plate. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility.Sep 28, 2017 · In theory when the insert is shorter than the read length you do read into the adapter at other end and then will sequence the index. Problem is not all inserts in your library are the same length and may not even be shorter than read length. So you would not be guaranteed to reach and read the index each time. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Enter 10 cycles each for Index 1 and Index 2 to ensure that the software reads the complete 10-base index adapter sequence. For the recommended number of Read 1 and Read 2 cycles, see the Compatible Products page for your kit. Illumina DNA Prep Compatible Products; Illumina DNA Prep with Enrichment Compatible Products; Nextera XT DNA Compatible ...Libraries prepared with Nextera XT kits are compatible with all Illumina sequencers. The IDT for Illumina-Nextera DNA UD Indexes Sets A, B, C, and D Indexes offer up to 384 unique dual indexing, which allows accurate assignment of reads and efficient use of the flow cell. These unique dual index codes use 10 bp codes.Mar 18, 2013 · Nextera XT index sequence 03-18-2013, 10:33 AM ... I'm hesitant to say anything more about them since they are patented by Illumina with limited permission for ... Sep 28, 2017 · In theory when the insert is shorter than the read length you do read into the adapter at other end and then will sequence the index. Problem is not all inserts in your library are the same length and may not even be shorter than read length. So you would not be guaranteed to reach and read the index each time. Illumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy <b ... Product Files This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. You can also download the appropriate sample sheet template (*.csv).Use the following sample sheet templates with IDT for Illumina Nextera DNA UD Indexes. Dual-index sequencing on a paired-end flow cell follows 1 of 2 workflows, depending on the system: Workflow A — The Index 2 Read is performed before Read 2 resynthesis, so the Index 2 (i5) adapter is sequenced on the forward strand.Illumina DNA Prep technology can be used to reduce library prep time from DNA extraction to library normalization, in applications such as: Whole-genome sequencing of any species (large or small) for various applications. Sequencing large numbers of genomic regions of interest, including whole exomes from Illumina or third party oligo vendors. Jul 18, 2012 · Illumina have released new Nextera Exome and Nextera Custom enrichment kits. These combine the rapid and simple sample prep of Nextera to in-solution genome capture and provide a straight-forward two-and-a-half day protocol. Add one day of sequencing on 2500 and you can expect your results in under one week. This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and Below are the 12 barcodes used in the Illumina TruSeq system, they are base-balanced and work well as In-Line barcodes as well as Multiplex. ATCACG CGATGT TTAGGC TGACCA ACATGT GCCAAT . CAGATC ACTTGA GATCAG TAGCTT GGCTAG CTTGTA . At this time, Illumina TruSeq adapters and primers are only available in the TruSeq kits from Illumina. The adaptor sequences in the middle like Truseq Read 1, Truseq Read 2, Nextera Read 1 and Nextera Read 2 can be changed. The entire kit costs $3,800 and it is sufficient for 10 experiments: Other consumables : Plates, tips, tubes: $40 : Charge for the use of the C1 instrument : $50: For one experiment: Estimated total cost for one mRNAseq C1 ... Illumina Adapter Sequences. Oligonucleotide (oligo) sequences of Illumina adapters used in library prep kits. This information is provided for use with Illumina instruments only. View Online Help. Apr 26, 2021. In the sequencing reagents provided by Illumina, the seuqencing primers are actually a mixture of different primers, including Truseq, Nextera and even those primers from kits that are obsolete. Therefore, you actually can sequence different types of libraries together. For example, Truseq librareis and Nextera libraries can be mixed together ...Illumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy <b ... The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Product Description IDT for Illumina DNA/RNA UD Indexes are extension-based unique dual (UD) indexes with unrelated adapters for both index reads. The index adapter sequences are 10 bases long. Sample Information Before preparing libraries, create a sample sheet to record the index adapter combinations and other information about your samples.Oct 29, 2010 · We used the Nextera multiplex primers to prepare several bacterial libraries, then pooled the libraries for one lane of Illumina sequencing. This was quite straightforward following the manufacturer's instructions. The libraries sequenced well and we could identify a perfect match to each 6 bp index sequence in 97% of the Illumina index reads. Illumina nextera xt index sequences. Illumina index adapter sequences. Related websites. Indexed Sequencing Overview for Illumina Systems. This documentation provides an overview of indexed sequencing for Illumina sequencing systems. Indexed sequencing is a method that allows multiple libraries to be pooled and sequenced together. Indexing ...Sequences for Nextera, Illumina Prep, and Illumina PCR Kits. Adapter Trimming. The following sequence is used for Read 1 and Read 2 adapter trimming. ... Index 2 Read. 5′ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC. Close Window. Revision History. Document # 1000000002694 v16. Documentation Feedback.Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. May 19, 2021 · This step will improve downstream data processing, such as sequence alignments and de novo assembly. The exact DNA sequence of the adapters depends on the library preparation kit that is used for sequencing. Illumina Nextera XT is one of our most used kits. The adapter sequence for this kit is: CTGTCTCTTATACACATCT Sep 28, 2017 · In theory when the insert is shorter than the read length you do read into the adapter at other end and then will sequence the index. Problem is not all inserts in your library are the same length and may not even be shorter than read length. So you would not be guaranteed to reach and read the index each time. Jun 13, 2020 · Option 1: Standard Nextera Flex. Allow BLT to equilibrate to room temp on the bench top for at least 30 minutes before use. Bring TB1 to room temp. Add 2–30 µl DNA to each well of a 96-well PCR plate so that the total input amount is 1–500 ng. If input is <100ng, quantify and normalize. The adaptor sequences in the middle like Truseq Read 1, Truseq Read 2, Nextera Read 1 and Nextera Read 2 can be changed. The entire kit costs $3,800 and it is sufficient for 10 experiments: Other consumables : Plates, tips, tubes: $40 : Charge for the use of the C1 instrument : $50: For one experiment: Estimated total cost for one mRNAseq C1 ... Prepared libraries were subjected to 100 base pair, paired-end sequencing on a HiSeq 2500 ( Illumina ... and the Illumina Nextera transposase and adapter sequences . In addition, reads were trimmed by 16bp at the 5' end to26].. Illumina - all flavors. ...Nextera DNA CD Indexes support up to 96-sample combinatorial dual indexing. The 24 CD Indexes are supplied in a tube format, and 96 in a plate format. For whole-genome sequencing, Illumina DNA Prep is the recommended replacement for the Nextera DNA Library Prep Kit, which has been discontinued.The IDT for Illumina RNA UD Indexes Sets A and B, Ligation kits (catalog numbers 20040553 and 20040554, respectively) include one IDT for Illumina DNA/RNA UD Index plate and one RNA Index Anchor plate. In contrast, IDT for Illumina DNA/RNA UD Indexes, Tagmentation kits only include the index plate.Aug 01, 2020 · However, here, we observed a decrease of sequence quality in samples containing a specific combination of indexes, namely N704 and S507 in Nextera kits, in multiple runs on the Illumina MiSeq sequencer operated in different facilities. Use the following sample sheet templates with IDT for Illumina Nextera DNA UD Indexes. Dual-index sequencing on a paired-end flow cell follows 1 of 2 workflows, depending on the system: Workflow A — The Index 2 Read is performed before Read 2 resynthesis, so the Index 2 (i5) adapter is sequenced on the forward strand. Below are the 12 barcodes used in the Illumina TruSeq system, they are base-balanced and work well as In-Line barcodes as well as Multiplex. ATCACG CGATGT TTAGGC TGACCA ACATGT GCCAAT . CAGATC ACTTGA GATCAG TAGCTT GGCTAG CTTGTA . At this time, Illumina TruSeq adapters and primers are only available in the TruSeq kits from Illumina. Sequences for Nextera, Illumina Prep, and Illumina PCR Kits. Adapter Trimming. The following sequence is used for Read 1 and Read 2 adapter trimming. ... Index 2 Read. 5′ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC. Close Window. Revision History. Document # 1000000002694 v16. Documentation Feedback.Illumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy <b ... Oct 29, 2010 · We used the Nextera multiplex primers to prepare several bacterial libraries, then pooled the libraries for one lane of Illumina sequencing. This was quite straightforward following the manufacturer's instructions. The libraries sequenced well and we could identify a perfect match to each 6 bp index sequence in 97% of the Illumina index reads. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Product Files This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. You can also download the appropriate sample sheet template (*.csv).The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. It is not recommended to sequence libraries made from different index sets (i.e. Nextera CD Indexes, IDT for Illumina TruSeq UD Indexes, or Nextera XT Index Kits). ... TruSeq Stranded mRNA, and TruSeq Stranded Total RNA library prep kits. The IDT for Illumina Nextera UD Indexes are extension based indexes that are compatible with the Nextera ...Illumina Adapter Sequences. Oligonucleotide (oligo) sequences of Illumina adapters used in library prep kits. This information is provided for use with Illumina instruments only. View Online Help. Apr 26, 2021. Sequences for Nextera, Illumina Prep, and Illumina PCR Kits. Adapter Trimming. The following sequence is used for Read 1 and Read 2 adapter trimming. ... Index 2 Read. 5′ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC. Close Window. Revision History. Document # 1000000002694 v16. Documentation Feedback.Jun 13, 2020 · Option 1: Standard Nextera Flex. Allow BLT to equilibrate to room temp on the bench top for at least 30 minutes before use. Bring TB1 to room temp. Add 2–30 µl DNA to each well of a 96-well PCR plate so that the total input amount is 1–500 ng. If input is <100ng, quantify and normalize. • IDT for Illumina Nextera DNA UD Indexes, Plate D adapter sequences for i5 bases iSeq, MiniSeq, NextSeq, HiSeq 3000/4000. • TruSight Tumor 170 UP08 i7 and i5 index names. • TruSight Tumor 170 UP08 and UP09 i7 adapter sequences. Document # 1000000002694 v11 April 2019 Added adapter sequences for IDT for Illumina The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. The benefits of unique dual indexing include: Greater efficiency for multiplexing. Reduced per-sample cost by allowing more indexes to be included in a sequencing run compared to combinatorial dual or single indexes. Highly purified and manufactured under Good Manufacturing Practice (GMP) conditions. Improved design with color balance in mind. Product Files This product was formerly named IDT for Illumina Nextera DNA UD Indexes. Import the appropriate definition file (*.tsv) or sample sheet (*.csv) into Local Run Manager. Illumina Experiment Manager v1.18.1 was updated with the index kits. You can also download the appropriate sample sheet template (*.csv).Nextera XT Indexes (24 indexes, 96 samples) are compatible with the Nextera DNA XT Library Prep Kit and bead-based normalization. For standard normalization, use the IDT for Illumina Nextera DNA UD Indexes. The Nextera XT Indexes (96 indexes, 384 samples) (catalog # FC-131-1002) was obsolesced with the introduction of the Nextera XT Index Kit v2.Enter 10 cycles each for Index 1 and Index 2 to ensure that the software reads the complete 10-base index adapter sequence. For the recommended number of Read 1 and Read 2 cycles, see the Compatible Products page for your kit. Illumina DNA Prep Compatible Products; Illumina DNA Prep with Enrichment Compatible Products; Nextera XT DNA Compatible ...Nextera DNA CD Indexes (24 indexes, 24 samples) contain six Index 1 (i7) adapters and four Index 2 (i5) adapters packaged in tubes. The following table shows strategies for pooling 3-8 dual-indexed libraries prepared with these indexes. A minimum plexity of three ensures that libraries are color balanced for sequencing on any Illumina system.Below are the 12 barcodes used in the Illumina TruSeq system, they are base-balanced and work well as In-Line barcodes as well as Multiplex. ATCACG CGATGT TTAGGC TGACCA ACATGT GCCAAT . CAGATC ACTTGA GATCAG TAGCTT GGCTAG CTTGTA . At this time, Illumina TruSeq adapters and primers are only available in the TruSeq kits from Illumina. This package can be used as part of the NGS Library Preparation protocol for Illumina Nextera XT. This package contains: Two sets of barcode indices : Illumina Nextera XT Index Kit and Illumina Nextera XT Index Kit v2. This is based on document: Illumina Adapter Sequences (1000000002694 v16) , Illumina Adapter Sequences v16. This package can be used as part of the NGS Library Preparation protocol for Illumina Nextera XT. This package contains: Two sets of barcode indices : Illumina Nextera XT Index Kit and Illumina Nextera XT Index Kit v2. This is based on document: Illumina Adapter Sequences (1000000002694 v16) , Illumina Adapter Sequences v16. Jun 13, 2020 · Option 1: Standard Nextera Flex. Allow BLT to equilibrate to room temp on the bench top for at least 30 minutes before use. Bring TB1 to room temp. Add 2–30 µl DNA to each well of a 96-well PCR plate so that the total input amount is 1–500 ng. If input is <100ng, quantify and normalize. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Nextera DNA CD Indexes (24 indexes, 24 samples) contain six Index 1 (i7) adapters and four Index 2 (i5) adapters packaged in tubes. The following table shows strategies for pooling 3-8 dual-indexed libraries prepared with these indexes. A minimum plexity of three ensures that libraries are color balanced for sequencing on any Illumina system.N504) for the 24 sample Nextera Index Kit (FC-121–1011). In the Index adapter name, the N refers to Nextera sample preparation, 7 or 5 refers to Index 1 (i7) or Index 2 (i5), respectively, and 01–12 refers to the Index number. A list of index sequences is provided for generating sample sheets to demultiplex the samples (Table 1). Nextera ... Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Sep 28, 2017 · In theory when the insert is shorter than the read length you do read into the adapter at other end and then will sequence the index. Problem is not all inserts in your library are the same length and may not even be shorter than read length. So you would not be guaranteed to reach and read the index each time. Jan 08, 2018 · The adapter oligo sequence is the same as the standard Illumina TruSeq HT (“TS-96”) dual indexed adapter; however, for each individual adapter, the i5 and i7 index sequences are identical, resulting in both the forward and reverse read indices having the same sequence, and the adapter contains a UMI appended to the 3′ end of the i7 index ... From here on the target DNA, forward, and reverse primers will be referred to as the "Insert". In the sequencing reagents provided by Illumina, the sequencing primers are actually a mixture of different primers, including TruSeq, Nextera and even primers from obsolete kits. Therefore, you actually can sequence different types of libraries together.This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Jan 08, 2018 · The adapter oligo sequence is the same as the standard Illumina TruSeq HT (“TS-96”) dual indexed adapter; however, for each individual adapter, the i5 and i7 index sequences are identical, resulting in both the forward and reverse read indices having the same sequence, and the adapter contains a UMI appended to the 3′ end of the i7 index ... AssessDNAQuality UVabsorbanceisacommonmethodforassessingthequalityofaDNAsample.Theratioof absorbanceat260 nmtoabsorbanceat280 nmisusedasanindicationofsamplepurity ... Feb 22, 2018 · Nextera XT Library prep kits have 2 sets of index primers (Index 1 and 2). Index 1 has up to 12 unique primers, while index 2 has up to 8 unique primers. A unique combination of an Index 1 and Index 2 primers are mixed with each sample, thus giving amplicons of each sample its own label after index PCR. Library Prep and Array Kit Selector. Determine the best kit for your project type, starting material, and method or application. Sequencing Coverage Calculator. Determine reagents and sequencing runs for your desired coverage. May 19, 2021 · This step will improve downstream data processing, such as sequence alignments and de novo assembly. The exact DNA sequence of the adapters depends on the library preparation kit that is used for sequencing. Illumina Nextera XT is one of our most used kits. The adapter sequence for this kit is: CTGTCTCTTATACACATCT Illumina Adapter Sequences: Nextera Index Kit - Index 2 (i5) Adapters: The i5 index names vary for different Nextera products as follows: • • • N50x—Nextera DNA: S50x—Nextera XT: E50x—Nextera Enrichment and Nextera Rapid Capture: i5 Bases for Sample Sheet: Bases in Adapter i5 Index Name MiSeq, HiSeq 2000/2500: i5 Bases for Sample Sheet Sequencing in the Same Channel: The Nextera sequencing primers are compatible with the Illumina sequencing primers, and can be used together. 9. Nextera PCR Enzyme: Use only Nextera PCR Enzyme for limited-cycle PCR (Step B, page 7). Other PCR systems have been tested and do not perform as well.The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Nextera XT DNA Library Preparation Kit Download: Data Sheet < 1 MB: Sequencing the Rapidly Evolving Influenza A Virus on the MiSeq System Download: Application Note < 1 MB: Apr 26, 2017: Nextera Library Validation and Cluster Density Optimization Download: Technical Note < 1 MB: Dec 6, 2018: Nextera XT Library Prep: Tips and Troubleshooting ... N504) for the 24 sample Nextera Index Kit (FC-121–1011). In the Index adapter name, the N refers to Nextera sample preparation, 7 or 5 refers to Index 1 (i7) or Index 2 (i5), respectively, and 01–12 refers to the Index number. A list of index sequences is provided for generating sample sheets to demultiplex the samples (Table 1). Nextera ... Nextera DNA CD Indexes (24 indexes, 24 samples) contain six Index 1 (i7) adapters and four Index 2 (i5) adapters packaged in tubes. The following table shows strategies for pooling 3–8 dual-indexed libraries prepared with these indexes. A minimum plexity of three ensures that libraries are color balanced for sequencing on any Illumina system ... The IDT for Illumina RNA UD Indexes Sets A and B, Ligation kits (catalog numbers 20040553 and 20040554, respectively) include one IDT for Illumina DNA/RNA UD Index plate and one RNA Index Anchor plate. In contrast, IDT for Illumina DNA/RNA UD Indexes, Tagmentation kits only include the index plate.Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Illumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy <b ... Nov 10, 2021 · Index sequences entered in the wrong orientation in the sample sheet. Incorrect index sequences entered in the sample sheet (eg, Nextera vs TruSeq UD or index A001 vs index A006). Sample mix ups between lanes. Poor Index Read sequencing quality. Ns in the sequences represent positions where the base calling software was unable to make a base call. Illumina Adapter Sequences. Oligonucleotide (oligo) sequences of Illumina adapters used in library prep kits. This information is provided for use with Illumina instruments only. View Online Help. Apr 26, 2021. The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. The IDT for Illumina RNA UD Indexes Sets A and B, Ligation kits (catalog numbers 20040553 and 20040554, respectively) include one IDT for Illumina DNA/RNA UD Index plate and one RNA Index Anchor plate. In contrast, IDT for Illumina DNA/RNA UD Indexes, Tagmentation kits only include the index plate.The PCR step adds index adapter sequences on both ends of the DNA, which enables dual-indexed sequencing of pooled libraries on Illumina sequencing platforms. These index adapters cannot be used with other library preps. TruSeq library prep uses adapter-embedded indexes to enable high throughput processing and application flexibility. Illumina Sequencing. Illumina sequencers deliver the most flexible and longest available reads of the shorter-read-length platforms, crossing important length thresholds to facilitate many genomic applications. Sequencing on an Illumina sequencer can be done by generating data from one end (single-end reads=SE) of the library fragments or from ... Illumina Sequencing. Illumina sequencers deliver the most flexible and longest available reads of the shorter-read-length platforms, crossing important length thresholds to facilitate many genomic applications. Sequencing on an Illumina sequencer can be done by generating data from one end (single-end reads=SE) of the library fragments or from ... Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. The IDT for Illumina RNA UD Indexes Sets A and B, Ligation kits (catalog numbers 20040553 and 20040554, respectively) include one IDT for Illumina DNA/RNA UD Index plate and one RNA Index Anchor plate. In contrast, IDT for Illumina DNA/RNA UD Indexes, Tagmentation kits only include the index plate.Index1(i7)Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5)Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC Index Name i7Basesin Adapter > i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq,MiSeq, HiSeq 2000/2500 i5BasesforSampleSheet iSeq,MiniSeq,NextSeq, HiSeq 3000/4000 UDP0001 CGCTCAGTTC GAACTGAGCG TCGTGGAGCG CGCTCCACGA. Illumina Adapter Sequences Document # 1000000002694v01 5 February 2016 Introduction This document lists the index adapter sequences for Illumina library prep kits. The sequences are grouped into sections for TruSight kits, Nextera kits, and TruSeq kits, with an appendix that lists TruSeq controls and information for legacy Illumina kits.Library Prep and Array Kit Selector. Determine the best kit for your project type, starting material, and method or application. Sequencing Coverage Calculator. Determine reagents and sequencing runs for your desired coverage.